Data C

Limnol. Oceanogr., **(*), ****, **** ****

E ****, by the American Society of Limnology and Oceanography, Inc.

doi:10.4319/lo.2010.55.5.2161

Polyphosphate in Trichodesmium from the low-phosphorus Sargasso Sea

Elizabeth D. Orchard,a Claudia R. Benitez-Nelson,b Perry J. Pellechia,c Michael W. Lomas,d and

Sonya T. Dyhrmane,*

a Massachusetts Institute of Technology Woods Hole Oceanographic Institution Joint Program in Oceanography/Applied Ocean Science

and Engineering, Woods Hole, Massachusetts

b Department of Earth and Ocean Sciences and Marine Sciences Program, University of South Carolina, Columbia, South Carolina

c Department of Chemistry and Biochemistry, University of South Carolina, Columbia, South Carolina

d Bermuda Institute of Ocean Sciences, St. George, Bermuda

e Biology Department, Woods Hole Oceanographic Institution, Woods Hole, Massachusetts

Abstract

Polyphosphate (polyP) is often considered to be the product of luxury uptake in areas of excess phosphorus

(P), but can also accumulate in P-depleted cells in response to P resupply. To test the hypothesis that polyP is

present in phytoplankton from oligotrophic systems, the marine diazotroph Trichodesmium was collected from

the low-P surface waters of the Sargasso Sea and assayed with solid-state 31P nuclear magnetic resonance

spectroscopy. Up to 25% of Trichodesmium cellular P was characterized as polyP, despite physiological data that

indicated the colonies were P deplete. This was consistent with culture studies where there were high percentages

of polyP under P-deplete conditions. All Trichodesmium species examined had the genetic machinery to produce

and degrade polyP. Trends in the amount of Trichodesmium polyP along the cruise transect showed that

allocation of P to polyP was consistently high, and that the ratio of polyP : carbon varied with changes in

temperature and mixed-layer depth. It may be that Trichodesmium was taking advantage of pulses in P supply,

and that polyP is a physiological fingerprint of this variability. Additionally, if polyP formation is a common trait

in phytoplankton, polyP released from cells could be an additional bioavailable component of the dissolved

organic P pool. Taken together, this study highlights the importance of polyP to P cycling and cellular P

allocation even in oligotrophic regions.

and in marine (Diaz et al. 2008) and freshwater (Bertilsson

Inorganic polyphosphate (polyP) is a polymer of

et al. 2003) phytoplankton culture experiments. Luxury

phosphate ranging in length from three to thousands of

orthophosphate units. PolyP synthesis and catabolism are uptake could drive the accumulation of polyP in coastal

typically controlled by a gene (ppK) encoding a polyP systems or areas where P is in excess relative to nitrogen

kinase that reversibly adds phosphate to the end of the (N). Fundamentally distinct from luxury uptake is the

polyP chain (Tzeng and Kornberg 1998), and a gene (ppX) overplus response, wherein P-deplete cells accumulate

encoding an exopolyphosphatase that removes the terminal polyP in response to short-term pulses in P supply

phosphate from a polyP molecule (Akiyama et al. 1993). (Jacobson and Halmann 1982; Bolier et al. 1992). The

PolyP has been found in all major groups of life examined overplus response is not well studied in marine phyto-

to date, but its function is varied, and in many regards plankton, or in marine systems in general. However, it has

remains unclear (Kornberg et al. 1999). Accumulation of been hypothesized that overplus could drive the cellular

cellular polyP has been variously attributed to a stationary accumulation of polyP in low-P systems where phytoplank-

phase adaptation, an energy storage compound, an osmotic ton are P deficient, but may experience short-term

regulator, a buffer against alkali conditions, a factor in variations in their local P environment (Karl and Bjorkman

deoxyribonucleic acid (DNA) competency (as part of a 2002).

DNA channel), and in intracellular phosphorus (P) storage Several different taxa of marine phytoplankton are

(Kornberg 1995; Kornberg et al. 1999). It is the link known to accumulate polyP, including Skeletonema,

between polyP and phosphate storage that has driven Thalassiosira, Synechocystis, Nostoc, Calothrix (Mateo et

research on polyP dynamics as a function of microbial P al. 2006; Diaz et al. 2008), and Trichodesmium, an N-fixing

physiology. marine cyanobacteria (Romans et al. 1994). Genes puta-

There are two basic processes that have been studied tively involved in polyP synthesis and degradation also

involving polyP formation in bacteria in response to P: appear to be present, and expressed, in a number of both

luxury uptake and the overplus response. Luxury uptake is eukaryotic (Dyhrman et al. 2006b) and prokaryotic

the storage of P as polyP when P is consistently in excess phytoplankton (Gomez-Garcia et al. 2003; Martiny et al.

relative to other macronutrients (e.g., growth is not P 2006; Hewson et al. 2009). Taken together, these observa-

controlled) and uptake exceeds instantaneous growth tions suggest that many phytoplankton produce and

demands. Luxury uptake has been extensively studied in degrade polyP, but despite its potential significance to P

wastewater treatment applications (Crocetti et al. 2000), physiology and P cycling, there are only a few studies that

have assayed polyP in a marine setting (Romans et al. 1994;

Diaz et al. 2008). Furthermore, the presence of phyto-

* Corresponding author: ********@****.***

2161

2162 Orchard et al.

Fig. 1. Station locations for a May 2006 transect from north to south in the Sargasso Sea.

plankton polyP has never been examined in a chronically colonies were picked into 0.2-mm-filtered local surface

low-P environment, such as the Sargasso Sea. seawater, and then transferred into fresh 0.2-mm-filtered

water to reduce contamination of closely associated

In this study, Trichodesmium near-surface populations

organisms. Colonies were then separated for further

from the Sargasso Sea were assayed with solid-state 31P

analyses as indicated below.

nuclear magnetic resonance (NMR) spectroscopy to

examine cellular allocation of P as polyP in an oligotrophic

31P NMR spectroscopy Trichodesmium biomass was

system. Results are compared to culture data, and

filtered onto 47-mm 5-mm polycarbonate filters and dried at

covarying field parameters, to examine potential drivers

65uC prior to analysis, according to conditions used in

of intracellular polyP dynamics.

other work (Benitez-Nelson et al. 2004; Dyhrman et al.

2009). For each field station, approximately 100 colonies

Methods

were pooled onto a single filter. Solid-state 31P NMR

spectra were recorded on a Varian Inova 500 spectrometer

Culture conditions Trichodesmium cultures were grown

operating at 202.489 MHz using a Doty Scientific XC-4 mm

in RMP medium with Sargasso seawater as previously

magic angle spinning (MAS) probe. Bloch decays of 50 ms

described (Webb et al. 2001). Species examined include

were collected with a 200 d or parts per million (ppm, 1026)

Trichodesmium erythraeum IMS101, Trichodesmium tenue

window after 30u excitation pulses. The number of

Z-1, Trichodesmium thiebautii II-3, Trichodesmium spiralis

transients collected varied, depending on the amount of

KAT, and Trichodesmium spp. H9-4 obtained from the

material on the filter, and ranged from 50,000 to 100,000

culture collection of Dr. John Waterbury at the Woods

scans per sample (24 48 h). Two-pulse phase modulation

Hole Oceanographic Institution. All cultures were unialgal

but not axenic. Cultures were grown at 25uC on a shaker (McGeorge et al. 1999) proton dipolar decoupling with a

field strength of 45 kHz was applied during acquisition, and

table with daily cycles that consisted of 1 h at

a MAS speed of 10 kHz was used. The chemical shift (a

13.5 mE m22 s21, 10 h at 33.7 mE m22 s21, 1 h at

unit-less normalization of frequency) is reported as 1026

13.5 mE m22 s21, and 12 h of dark. Chlorophyll a

(ppm). Spectra were fit with five Lorentzian lines at a

fluorescence was monitored using an Aquafluor fluorom-

chemical shift of 18 to 20 (nominally phosphonate), 0 to 2

eter (Turner Designs). T. erythraeum IMS101 was grown

with (+P) and without (2P) 16 mmol L21 phosphoric acid (nominally orthophosphate), 212 (a sharp peak approxi-

mating a monospecific, but uncharacterized diester), 210

added to the media. Samples were taken for particulate

carbon (C), N, and P as well as for solid-state 31P NMR to 212 (a broader spectrum of diesters), and 222 to 224

spectroscopy (see below) throughout the experiments. (nominally polyP). The percentage of total P as polyP was

then determined (Fig. 2). This is likely to be a minimum

measurement given the assumption that all polyP has a

Field samples Samples were collected during a transect

of the Sargasso Sea (Sta. 1 7) in May 2006 (Fig. 1). peak signal within this 222 to 224 region. Results are

reported as a %polyP of total P or as the polyP : C. The

Trichodesmium colonies were collected from the near

surface (roughly within the top 20 m) using a handheld later value was determined as the proportion of polyP

130-mm net. Colonies were not sorted by morphology, but multiplied by the ratio of total P : C in the sample to

the puff morphology was typically most abundant. Single account for changes in the absolute amount of P in the

Trichodesmium polyphosphate dynamics 2163

to the persulfate oxidation method (Valderrama 1981).

Dissolved organic P (DOP) concentrations were calculated

as the difference between TDP and DIP. With the methods

used herein, polyP would be detected within the DOP pool

even though it may occur as an inorganic compound

(Monaghan and Ruttenberg 1999).

Statistics Pair-wise correlation coefficients (corr. coeff.)

and p values were calculated between all parameters:

Trichodesmium polyP : C, Trichodesmium APA, Trichodes-

mium N : P ratio, Trichodesmium C : P ratio, surface temper-

ature, mixed-layer depth, latitude, DOP concentration, and

DIP concentration at 20 m, using JMP software (SAS). The

mixed-layer depth was defined as the depth where the

temperature changed by 0.5uC relative to the surface. A two-

tailed t-test was used to compare %polyP among growth

phases of cultured Trichodesmium and between P-replete and

Fig. 2. A representative solid-state 31P NMR spectrum of

P-deplete culture treatments.

Trichodesmium from Sta. 2 during a May 2006 cruise transect in

the Sargasso Sea; the polyP peak is noted at a chemical shift of

222 to 224. Genome annotation The putative ppX and ppK genes

were identified using the Integrated Microbial Genomes

sample due to variations in P quota. The %polyP values portal at the Joint Genome Institute US Department of

reported have an error of 6 5%, similar to solid-state 31P Energy website (http://img.jgi.doe.gov/v1.1/main.cgi) and

NMR studies in other systems (Sannigrahi and Ingall 2005; the National Center for Biotechnology Information Gen-

Sannigrahi et al. 2006; Diaz et al. 2008). It is important to bank database (http://www.ncbi.nlm.nih.gov/), based on

note that Trichodesmium cultures and colonies likely homology.

contained epibionts. However, the particulate P was

dominated by Trichodesmium, and thus the epibionts DNA amplification and sequencing Cultures of Tricho-

should not have a major influence on the proportion of P desmium were collected by filtration onto a 5-mm polycar-

bonate filter and stored at 220uC until extraction. DNA

detected in a given bond class.

was extracted using the Instagene Matrix (Bio-Rad)

Alkaline phosphatase activity (APA) For Trichodes- according to the manufacturer s instructions or as de-

mium APA assays, 325 colonies were filtered onto a 5-mm scribed in Ehrenreich et al. (2005). Polymerase chain

polycarbonate filter. Samples were processed as described reaction (PCR) primers were designed to either amplify

elsewhere (Dyhrman and Ruttenberg 2006). Briefly, fragments of the putative ppX (F 59 GGAATGTCCGA

10 mmol L21 6,8-difluoro-4-methylumbelliferyl phosphate AAAGCGAGC 39 R 59 GCCCAAAAAGCAACCCC

GTTC 39) or ppK (F 59 CGCTTTATCAAACTGATT

(di-MUF-P; Invitrogen) was added to each sample in a

petri dish with artificial seawater containing no P, and CGTCGG 39 R 59 CGCAAACAACAAATACCACG

GAC 39) genes. Each PCR reaction consisted of a 5-min

fluorescence was measured on a Fluostar Optima plate

denaturation step at 95uC, followed by 35 cycles of 1 min at

reader (BMG Labtech) every 5 20 min for five time points,

95uC, 1 min at 60.7uC, 1 min at 72uC, and a final extension

within the linear range of the assay. Previous kinetics

of 10 min at 72uC, in a Bio-Rad iCycler. PCR amplification

experiments found the 10 mmol L21 substrate concentration

was done using 0.5 mL iTaq DNA polymerase (Bio-Rad),

to be saturating (data not shown). Standard fluorescence

2.5 mL of DNA template, 2.5 mL of 2 mmol L21

curves were generated for each assay using 6,8-difluoro-7-

deoxyribonucleotide triphosphate, 2.5 mL of 53 iTaq

hydroxy-4-methylcoumarin.

buffer, 50 pmol of each primer, and sterile water to a final

volume of 25 mL. The PCR products were gel extracted

Chemical analyses For C, N, and total P measurements

using the QIAquick gel extraction kit (Qiagen), and direct

20 Trichodesmium colonies from the field were collected

onto precombusted GF/F filters and dried at 65uC in sequenced at the MWG Biotech facility or at the University

of Maine, according to the facility s protocols. Sequences

precombusted foil. Each filter was split for analysis of C, N,

were edited using Sequencher (Gene Codes) and verified

and total particulate P. C and N concentrations were

manually. Alignments were done in MacVector. The

measured using a Perkin Elmer 2400 CHN Element

sequences have been deposited in Genbank (accession

Autoanalyzer with no acid fuming (Karl et al. 1991). Total

number GU299287 GU299292).

particulate P was measured as described in Benitez-Nelson

et al. (2004). Soluble reactive P (SRP) was measured

according to the magnesium-induced coprecipitation SRP Results

method (Karl and Tien 1992), with a detection limit of

0.5 nmol L21. SRP concentrations measured here are Genes T. erythraeum has gene homologs for ppK and

referred to as the dissolved inorganic P (DIP) concentra- for ppX. The genes are not contiguous, and do not appear

tion. The total dissolved P (TDP) was processed according to be downstream of a Pho box P regulatory sequence (Su

2164 Orchard et al.

mixed-layer depth (Table 2). There was no significant

Table 1. The %polyP detected in T. erythraeum IMS101

cultures grown on P-replete or P-deplete media in different correlation between Trichodesmium polyP : C and DOP,

growth phases. DIP, Trichodesmium N : P ratio, or Trichodesmium APA.

There was also no significant correlation between Tricho-

Log phase P- Stationary phase P- Log phase P-

desmium APA and DIP concentration, Trichodesmium C : P

replete* (n58) replete (n54) deplete (n53)

ratio, or Trichodesmium N : P ratio.

Mean 0.2{ 16 16

SD 0.5 9 13 Discussion

p{ 0.0003 0.006

Storage of cellular P as polyP is considered an important

* The average C : P ratio for the P-replete cultures was 130 6 35, and for

the P-deplete samples was 486 6 201. aspect of microbial P physiology, and could influence P

{ Each %polyP value has a 6 5% error.

cycling in aquatic systems. However, there are few studies

{ All samples were compared to the log phase P-replete condition using a

that have examined polyP in marine phytoplankton, and

two-tailed t-test; bold font denotes significance.

none have examined polyP accumulation in low-P oligo-

trophic systems. Others have hypothesized that polyP could

et al. 2007), although previous work has highlighted that

accumulate in phytoplankton from oligotrophic, low-P

there may be heterogeneity in the Trichodesmium Pho box

regions, as part of an overplus-type response (Karl and

sequence (Orchard et al. 2009). All species of Trichodes-

Bjorkman 2002). To address this hypothesis, polyP was

mium tested (T. erythraeum, T. spiralis, T. tenue, and T.

assayed in Trichodesmium cultures and from field popula-

thiebautii) had the ppK and ppX genes. Over the sequenced

tions from the Sargasso Sea.

156 base pair fragment, ppK is 88 93% identical at the

nucleotide level. The sequenced 223 base pair fragment of

PolyP dynamics in culture All of the Trichodesmium

ppX is 93 100% identical at the nucleotide level.

species tested in culture have the genetic machinery to

produce and degrade polyP. This is consistent with solid-

Culture experiments Multiple Trichodesmium species

state 31P NMR data that detected polyP in P-replete

had detectable polyP. The maximum %polyP that was

cultures of Trichodesmium, with maximal polyP percentag-

measured in P-replete cultures was 12% for T. tenue, 14%

es that were similar among species. These data suggest that

for T. spp. H9-4, 19% for T. thiebautii, and 22% for T.

the polyP dynamics observed in T. erythraeum IMS101 are

erythraeum. The %polyP in P-replete T. erythraeum

likely representative of the other species, although this

IMS101 cultures was significantly lower in log phase than

warrants further study. The solid-state 31P NMR method is

in stationary phase (Table 1). The %polyP in log phase P-

nondestructive and can provide data on P allocation

replete cultures (cultures with a C : P ratio less than 200)

patterns that are complementary to other approaches that

was significantly lower than log phase P-deplete cultures

have detected polyP accumulated in granules in Trichodes-

(grown with no added P and with a C : P ratio greater than

mium populations from the Caribbean Sea using electron

200; Table 1).

microscopy (Romans et al. 1994).

Under P-replete conditions, T. erythraeum IMS101 had

Field data The surface temperature increased with

the highest %polyP of total cellular P during stationary

decreasing latitude from north to south increasing from

24.6uC to 27.7uC (Table 2). The mixed-layer depth gener- phase. In fact, polyP was often below the detection limit in

P-replete log phase cultures. This is consistent with the

ally shoaled in the more southern latitudes decreasing from

hypothesis that polyP is important for survival in

a maximum of 32 m to a minimum of 13 m (Table 2). DIP

stationary phase or that polyP is accumulating in response

and DOP concentrations at 20 m were relatively constant

to general stress (Rao and Kornberg 1996; Kornberg et al.

along the cruise transect, ranging from 0.5 to 3.0 nmol L21

1999). Luxury uptake may also be occurring in these

and 22.9 to 46.8 nmol L21, respectively, and with no clear

cultures, but luxury P is either not being stored as polyP

trend from north to south (Table 2). The average Tricho-

during log phase growth or is below the detection limit for

desmium C : P ratio and N : P ratio were consistently above

this assay. These results contrast with those from P-deplete

the Redfield ratio of 106 : 1 and 16 : 1, respectively, and

cultures, where log phase P-deplete samples had signifi-

Trichodesmium APA ranged from 0.23 to 0.97 nmol P h21

cantly higher percentages of polyP relative to log phase P-

colony21 (Table 2). None of these potential metrics of P

replete samples. This could be the result of an overplus-like

physiology showed a consistent trend on the north to south

response (Fig. 3). Because DIP was not refed to P-deplete

transect (Table 2), or a significant correlation to other

cells, this is not entirely consistent with traditional

environmental parameters. However, these metrics of P

definitions of the overplus response. However, upon

physiology were consistently in the range of what would be

becoming P-deplete T. erythraeum up-regulates a suite of

considered evidence of P depletion from other studies

genes encoding enzymes to access P from DOP (Dyhrman

(Mulholland et al. 2002; Krauk et al. 2006; White et al.

et al. 2006a; Orchard et al. 2009). These cultures were

2006b).

grown on Sargasso Sea water containing DOP, and cells

In field-collected Trichodesmium colonies, %polyP

would have been able to access a new source of P upon DIP

ranged from 8% to 25% of the total P as detected with

depletion, the result of which might have been an overplus-

solid-state 31P NMR spectroscopy (Table 2). The polyP

like accumulation of polyP (Fig. 3). This could be

normalized between stations as the polyP : C ratio was

significantly correlated with temperature, latitude, and analogous to what could happen in P-deplete oligotrophic

Trichodesmium polyphosphate dynamics 2165

systems where cells experience variation in the P supply

Table 2. PolyP : C in Trichodesmium field samples compared to %polyP and indicators of Trichodesmium P physiology, including C : P, N : P, APA, and chemical and

Temperature Mixed-layer

through switching between growth on low-concentration

depth (m)

0.90

0.04

DIP to growth on comparatively higher concentrations of

17.5

5

32

19

30

13

24

17

DOP.

PolyP dynamics in the Sargasso Sea PolyP accumula-

tion in phytoplankton has previously been observed in the

20.92

0.03

coastal zone and eutrophic lakes, and in these regions

(uC)

24.6

25.7

25.3

26.2

26.8

27.9

27.7

5

polyP accumulation was generally attributed to luxury

uptake of P (Schelske and Sicko-Goad 1990; Diaz

et al. 2008). In the oligotrophic Sargasso Sea polyP was

between 8% and 25% of the total cellular P in Trichodes-

Latitude

27.67

26.66

25.66

24.66

23.66

22.66

21.66

0.87

0.05

mium despite the low DIP concentrations in this area

5

(, 5 nmol L21). These data are striking in that they

demonstrate that even in low-P regions some phytoplank-

{ Pairwise correlations reported as correlation coefficients (corr. coeff.) are compared to polyP : C at each station; bold font denotes significance.

ton sequester a significant proportion of their cellular P as

colony21 h21) (nmol L21) (nmol L21)

polyP. These field data are consistent with the culture

20.32

0.60

DIP

1.1

1.5

0.5

3.0

0.8

1.4

0.5

results that highlight the allocation of P to polyP can be

5

elevated in P-deplete Trichodesmium.

Unlike the other marine systems that have been

examined (e.g., Caribbean; Romans et al. 1994), the

0.20

0.75

DOP

43.1

22.9

46.8

28.9

45.2

45.6

presence of high percentages of polyP in Trichodesmium

5

nd

from the Sargasso Sea is unlikely to be due to luxury

uptake. Evidence from culture studies suggest Trichodes-

mium may be capable of luxury uptake (White et al. 2006b),

physical parameters from a north-to-south cruise transect in the Sargasso Sea. nd, not determined.

but elevated N : P, C : P, and APA (metrics of P deficiency)

(nmol P

APA

0.93

0.39

0.56

0.23

0.97

0.46

0.94

0.22

0.72

in this study and others from the region suggest that

5

Trichodesmium populations are P deficient (Dyhrman et al.

Contact this candidate