Control Distribution

Evidence for Significant Overlap between Common Risk

Variants for Crohn s Disease and Ankylosing Spondylitis

Debby Laukens1, Michel Georges2, Cecile Libioulle2, Cynthia Sandor2, Myriam Mni2, Bert Vander

Cruyssen3, Harald Peeters1, Dirk Elewaut3., Martine De Vos1*.

`ge, Liege,

`

1 Department of Gastroenterology, Ghent University, Ghent, Belgium, 2 Unit of Animal Genomics, GIGA-R and Faculty of Veterinary Medicine, University of Lie

Belgium, 3 Department of Rheumatology, Ghent University, Ghent, Belgium

Abstract

Background: A multicenter genome-wide association scan for Crohn s Disease (CD) has recently reported 40 CD

susceptibility loci, including 29 novel ones (19 significant and 10 putative). To gain insight into the genetic overlap between

CD and ankylosing spondylitis (AS), these markers were tested for association in AS patients.

Principal Findings: Two previously established associations, namely with the MHC and IL23R loci, were confirmed. In

addition, rs2872507, which maps to a locus associated with asthma and influences the expression of the ORMDL3 gene in

lymphoblastoid cells, showed a significant association with AS (p = 0.03). In gut biopsies of AS and CD patients, ORMDL3

expression was not significantly different from controls and no correlation was found with the rs2872507 genotype

(Spearman s rho: 20.067). The distribution of p-values for the remaining 36 SNPs was significantly skewed towards low p-

values unless the top 5 ranked SNPs (ORMDL3, NKX2 3, PTPN2, ICOSLG and MST1) were excluded from the analysis.

Conclusions: Association analysis using risk variants for CD led to the identification of a new risk variant associated with AS

(ORMDL3), underscoring a role for ER stress in AS. In addition, two known and five potentially relevant associations were

detected, contributing to common susceptibility of CD and AS.

Citation: Laukens D, Georges M, Libioulle C, Sandor C, Mni M, et al. (2010) Evidence for Significant Overlap between Common Risk Variants for Crohn s Disease

and Ankylosing Spondylitis. PLoS ONE 5(11): e13795. doi:10.1371/journal.pone.0013795

Editor: Antje Timmer, HelmholtzZentrum Munchen, Germany

Received July 8, 2009; Accepted September 27, 2010; Published November 2, 2010

Copyright: 2010 Laukens et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits

unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by grants from (i) La Direction Ge rale des Technologies de la Recherche et de l Energie from the Walloon Region (DGTRE, nr

ne

315422), (ii) The 2nd Excellence Programme from the Walloon Region called CIBLES, (iii) from the Communaute Francaise de Belgique (Biomod ARC), (iv) the

Belgian Science Policy organization (SSTC Genefunc and Biomagnet PAI) and (v) by a concerted action grant BOF07/GOA/002 of Ghent University, Belgium.

`

Cynthia Sandor is a fellow of the Formation a la Recherche dans l Industrie et dans l Agriculture (FRIA). The funders had no role in study design, data collection and

analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: abp8cy@r.postjobfree.com

. These authors contributed equally to this work.

and the spine and sacroiliac joints [8,9]. Although very distinct and

Introduction

well defined entities, there is clinical and genetic evidence

Genome wide association studies (GWAS) are revealing increasing supporting some degree of overlap between the pathogenesis of

numbers of common risk variants for a growing list of pathologies. the two entities. Crohn s disease is associated in up to 30% of the

Common themes emerging from GWAS include (i) the polygenic patients with articular pathology including sacroilliitis, spondylitis

architecture of most common diseases, including many risk variants and/or peripheral arthritis [10]. Prior studies also demonstrated

with individually small effects, (ii) the absence of convincing epistatic evidence for the presence of asymptomatic chronic intestinal

interactions between common risk variants, and (iii) the fact that the inflammation in a subgroup of patients with spondylarthritis (SpA)

common variants detected to date typically account for less than associated with an increased risk for the development of CD [11].

20% of the genetic risk. Association mapping greatly benefits from HLA-B27 has been known for a long time to be a major risk factor

meta-analyses, as pooling of medium sized cohorts considerably for AS [12], while the previously suspected influence of the MHC

increases the power to detect the mainly small genetic effects [1]. on CD susceptibility has recently been clearly confirmed [7]. As

An additional noteworthy outcome of recent GWAS are the mentioned before, IL23R variants have been shown to be associated

connections that are being established between diseases initially with both CD and AS [2,4]. Risk variants for CD in NOD2 have also

considered unrelated, through the identification of shared risk been shown to increase the risk for chronic gut inflammation in SpA

variants. Examples include the association of IL23R variants with patients [13]. Finally, animal models including HLA-B27/human

b2-microglobulin transgenic rats and TNFDARE mice, support links

Crohn s disease (CD), psoriasis and ankylosing spondylitis, of

PTPN2 variants with CD and type 1 diabetes, and of ORMDL3 between articular and gut inflammation [14,15].

variants with asthma and CD [2 7]. Through a meta-analysis involving a total of 6,894 CD cases

Crohn s disease and ankylosing spondylitis (AS) are idiopathic, and 9,316 controls of Caucasian descent, we recently identified 19

chronic inflammatory disorders of, respectively, the intestinal tract novel CD risk loci in addition to 11 previously identified ones.

PLoS ONE www.plosone.org 1 November 2010 Volume 5 Issue 11 e13795

Risk Variants for CD and AS

Moreover, we presented strongly suggestive evidence for at least thus equating to a p-value of 0.0007, strongly suggesting the

10 more loci, for a total of 40 CD risk loci [7]. To further examine occurrence of true alternative hypotheses amongst the 36 remaining

the potential overlap between the inherited susceptibility to CD SNPs. The same approach was successively applied to the 35, 34,

and AS, we genotyped a cohort of 182 AS patients for SNP 33, 32, SNPs with highest p-values, i.e. progressively dropping

markers corresponding to 39 of these 40 CD risk loci described in the SNP with lowest p-values and verifying whether the remaining

distributions were still significantly skewed towards low values. The

Barrett et al. and evaluated their effect on AS outcome [7]. NOD2

outcome of this analysis is shown in Fig. 1. It indicates that the top

was not included in the analysis because we and others have shown

four SNPs, at least, are very likely to affect the risk of developing AS.

that none of the three CD-associated SNPs are associated with AS

[13,16].

Discussion

Results

We herein first confirm two previously established associations

with the risk to develop AS, respectively with the MHC and IL23R

As expected, a highly significant association (p = 0.00004) was

loci.

found with rs3763313, corresponding to the well established major

effect of the MHC [12]. In addition, we observed a nominally In addition, we report a novel association between AS and a

significant association (p = 0.04) with rs11209026, which is in SNP mapping at position 35,294,289 of human chromosome 17.

agreement with the previously described effect on AS of the IL23R Remarkably, rs2872507 maps to a locus shown first to be

locus (Supporting Table S1) [4]. associated with asthma [6] and subsequently with CD [7].

Rs2872507 was shown to be associated with expression levels of

Of the remaining 37 SNPs, rs2872507 showed a significant

the closely linked ORMDL3 and GSDML genes in lymphoblastoid

association with AS after Bonferroni correction for 37 new tests

cell lines, which therefore stood out as prime candidate genes

(p = 0.03), this being a strong candidate for a novel AS

[6,7]. However we could not detect differential expression of

susceptibility locus. Because this SNP has been shown to influence

ORMDL3 in whole gut biopsies of patients with CD or AS.

the expression of the ORMDL3 gene [7], we measured the

Although this polymorphism has been shown to influence the

transcript abundance of this gene in endoscopically healthy

expression of ORMDL3 in lymphoblastoid cells, it is likely that such

intestinal biopsies of patients with AS, CD and ulcerative colitis

influences might play only a marginal role in complex tissue such

(UC) (patient characteristics Table 1). No difference was found in

as gut biopsies. Alternatively, SNPs in LD with rs2872507 might

ORMDL3 mRNA expression in the colon or ileum of CD, UC and

have more profound control on the expression of ORMDL3.

AS patients as compared to healthy controls. In addition, no

correlation was found between the expression of this gene and the Using a survey of SNPs surrounding the ORMDL3 gene

rs2872507 genotype AA/AG/GG (Spearman s Rho: 2147 for the genotyped in the Welcome Trust case consortium dataset, no

total group, N = 82; 0.147 for ileal biopsies only, N = 32; 0.138 for association was found with AS (personal communication). The

colonic biopsies only, N = 50). population used in this study might contain a bias towards patients

with subclinical gut alterations, since the patients were sampled as

None of the other 36 SNPs yielded significant p-values after

the result of a collaboration between the departments of

Bonferroni correction, which was not really a surprise given the

rheumatology and gastroenterology. HLA-B27, a well-known risk

small size of the studied AS cohort. However, it is well established

factor associated with AS, has the tendency to misfold during class

that one can gain additional statistical power by examining the

I complex formation in the endoplasmic reticulum (ER). As such,

distribution of p-values across a series of tests rather than

ORMDL3 represents an interesting candidate gene for AS, as this

considering each of them individually [17]. Thus, we verified

protein resides in the ER and overexpression of this gene facilitates

whether the remaining 36 SNPs were showing an excess of low p-

the activation of the unfolded protein response [18].

values when compared to a typical distribution of p-values expected

for 36 true null hypotheses. The sum of log(1/pi) values obtained By applying a method that seeks to extract information from the

with the 36 SNPs was only reached for 7 out of 10,000 simulations, distribution of p-values rather than individual ones, we provide

Table 1. Clinical features of the patient population recruited for intestinal ORMDL3 gene expression analysis.

Colonic biopsies Ileal biopsies

control CD UC AS control CD UC AS

N **-**-**-**-**-** 11 10

Gender (M/F) 9/12 18/21 7/3 8/6 8/9 12/12 4/7 4/6

Age, yrs (mean, range) 50 (22 69) 38 (11 73) 45 (25 61) 36 (16 51) 51 (27 69) 37 (11 66) 32 (7 51) 35 (16 44)

Age at diagnosis (A1/A2/A3) 3/28/8 0/4/6 3/15/6 1/8/2

Disease location (L1/L2/L3/L4) 15/5/18/1 4/8/11/1

Rs2872507 (AA/AG/GG/unknown) 3/6/6/6 9/11/1/18 0/3/0/7 0/7/4/3 2/3/5/7 3/9/1/11 0/1/0/10 0/5/3/2

Medication intake:

no **-**-*-*-**-**-** 1

5-aminosalicylates 0 9 3 0 5 1

NSAID 12 9

A1:0 16 yrs; A2:16 40 yrs; A3: $40 yrs; disease location is defined as maximal extension of inflammation before first resection. L1: ileal involvement only, L2: colonic

involvement only, L3: ileal and colonic involvement. NSAID: non-steroidal anti-inflammatory drugs.

doi:10.1371/journal.pone.0013795.t001

PLoS ONE www.plosone.org 2 November 2010 Volume 5 Issue 11 e13795

Risk Variants for CD and AS

Figure 1. Association of 36 SNPs known to influence CD risk with AS. SNPs are ordered on the X-axis by increasing p-value. Y-axis: log10(1/p),

corresponding to (i) nominal p-values (gray), (ii) Bonferroni corrected p-values (blue), (iii) expected distribution of p-values assuming that all SNPs are

true null hypotheses (black), and (iv) the p-value of the distribution of individual p-values for the corresponding marker plus all the less significant

ones (red). The horizontal line corresponds to a p-value of 0.05. The names of gene of interest in the vicinity of the associated SNPs as well as the

number of genes in the confidence interval (defined according to [7]) are given for the five most interesting SNPs, exceeding the 0.05 significance

threshold using the approach that extracts information from the p-value distribution.

doi:10.1371/journal.pone.0013795.g001

evidence for an addition of four novel AS risk loci. The three first (ORMLD3) of the 37 SNPs not previously known to affect AS.

However, the distribution of p-values for the remaining 36 SNPs

of these define an LD-based confidence interval encompassing one

was significantly skewed towards low p-values unless the top 5

gene each: NKX2-3, PTPN2 and ICOSLG [7]. As mentioned before,

SNPs were removed from the analysis, hence supporting at least

PTPN2 is particularly interesting as it has been implicated before in

five novel associations with AS.

the pathogenesis of CD [7] and type I diabetes [19]. The sign of the

association is apparently the same for the three diseases, i.e. the

Materials and Methods

same allele increases risk for the three pathologies. ICOSLG is also

very interesting because of its known involvement in the regulation

Ethics Statement

of immune response [20,21]. The fourth SNP defines a confidence

This study was approved by the ethics committee of the University

interval encompassing 35 genes, including MST1 which has recently

Hospital Ghent (nos. 2000/242 and 2004/242) and each participant

been implicated in the pathogenesis of CD [22].

obtained a written informed consent form. This form was signed by

One could argue that the observed skewed distribution of p-

the participants and approved by the ethics committee.

values reflects population stratification rather than genuine

associations. While we cannot formally refute this possibility on

Patients

the basis of the available data, we consider this to be an unlikely

All included patients fulfilled the modified New York criteria for

hypothesis. Indeed, the controls originated from the same

definite AS [23], were of self-reported white ancestry, born

geographical region as the cases, namely Belgium, and were

between 1930 and 1986. Patients were followed at the Rheuma-

subjected to the same ethnicity criteria. Moreover, the exact same

tology Department of the University Hospital in Ghent. The male

control cohort has been successfully used as confirmation cohort in

to female ratio was 2.4. Patients with abdominal inflammatory

an association study for CD based on Belgian cases [7].

symptoms were not included in this analysis.

In conclusion, we herein provide evidence for an important

overlap between the determinants of inherited predisposition to

Genotyping

CD and AS. Prior to this study the MHC and IL23R loci were

known to be implicated in the susceptibility to both diseases. We Genotyping was performed using the Illumina Golden Gate

have studied an additional 37 recently defined CD risk loci. Given assay previously used on the Belgian-French cohort in the CD

the limited size of the studied AS cohort, the significance threshold meta-analysis [7]. The genotyping success rate for the AS patients

that were retained for analysis was $97% and all markers were in

associated with a Type-I error of 5% (accounting for the

realization of 37 independent tests), was only exceeded for one Hardy-Weinberg equilibrium in the control population [7].

PLoS ONE www.plosone.org 3 November 2010 Volume 5 Issue 11 e13795

Risk Variants for CD and AS

GAACAAGAGGGCATCTG; CCACCACTGCATCAAATTC-

Quantitative real-time PCR

ATG (E = 105; R2 = 0.994).

For ORMDL3 gene expression analysis, endoscopically healthy

biopsies were retrieved during colonoscopy. Total RNA was

Statistics

extracted from the biopsies using the RNeasy Mini Kit (Qiagen

Benelux, Venlo, The Netherlands). The quality of each sample Marker allele frequencies were compared between AS cases and

was determined using automated gelelectrophoresis (Experion previously described Belgian replication controls, using a one-sided

Systems, Maynard, MA, USA, RQI range 7.6 10). Twenty ng of Fisher s exact test imposing an allelic effect with the same sign as

total RNA was converted to cDNA and amplified using the WT- observed for CD [7]. For the 36 SNPs that did not exceed

Ovation RNA amplification system (Nugen Technologies, Bem- Bonferroni-adjusted significance thresholds, we compared the

mel, The Netherlands). Ten ng of amplified cDNA was used in distribution of p-values with that expected for 36 true null

P35

i~1 log 1=pi

SYBRGreen real-time quantitative PCR using automated pipett- hypotheses. This was achieved by comparing

ing (Caliper ALH3000, Caliper Life Sciences, Teralfene, Belgium). obtained with the real data, with the distribution of 10,000

P35

Cycling conditions were 95uC for 10 minutes and 44 cycles of i~1 log 1=ri, where ri are random numbers drawn between 0

95uC for 10 seconds and 60uC for 30 seconds (Bio-Rad CFX384, and 1. Gene expression differences between groups were evaluated

Bio-Rad Laboratories, Nazareth, Belgium). Melting curve analysis by the Kruskal-Wallis statistic with Dunn s multiple comparison test.

confirmed primers specificities. The amplification efficiencies of

the primer pairs were calculated using a standard curve of Supporting Information

reference genomic DNA. Amplification efficiency was determined

Table S1

using the formula 1021/slope. ORMDL3 expression was normalized

Found at: doi:10.1371/journal.pone.0013795.s001 (0.22 MB

with the geometric mean value of three reference genes. Primer

DOC)

sequences for ORMDL3 detection were GTAAAAGGCATGTG-

CTGCAA; CCCAACCCCACTACAAGCTA (E = 105% R2 =

Author Contributions

0.999), for GAPDH TGCACCACCAACTGCTTAGC; GGC-

ATGGACTGTGGTCATGAG (E = 110%; R2 = 0.990), for Conceived and designed the experiments: DL MG DE MdV. Performed

HPRT TGACACTGGCAAAACAATGCA; GGTCCTTTTCA- the experiments: CL CS MM. Analyzed the data: CL. Wrote the paper:

CCAGCAAGCT (E = 111%; R2 = 0.998) and for SDHA TGG- DL MG. Patient recruitment: BVC HP DE.

References

1. McCarthy MI, Abecasis GR, Cardon LR, Goldstein DB, Little J, et al. (2008) identify a specific phenotype previously related to Crohn s disease. Ann Rheum

Genome-wide association studies for complex traits: consensus, uncertainty and Dis 64: 930 5.

challenges. Nat Rev Genet 9: 356 69. 14. Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli F, Kollias G (1999)

2. Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, et al. (2006) A Impaired on/off regulation of TNF biosynthesis in mice lacking TNF AU-rich

genome-wide association study identifies IL23R as an inflammatory bowel elements: implications for joint and gut-associated immunopathologies. Immu-

disease gene. Science 314: 1461 3. nity 10: 387 98.

3. Cargill M, Schrodi SJ, Chang M, Garcia VE, Brandon R, et al. (2007) A large- 15. Taurog JD, Maika SD, Simmons WA, Breban M, Hammer RE (1993)

scale genetic association study confirms IL12B and leads to the identification of Susceptibility to inflammatory disease in HLA-B27 transgenic rat lines correlates

IL23R as psoriasis-risk genes. Am J Hum Genet 80: 273 90. with the level of B27 expression. J Immunol 150: 4168 78.

4. Burton PR, Clayton DG, Cardon LR, Craddock N, Deloukas P, et al. (2007) 16. Miceli-Richard C, Zouali H, Lesage S, Thomas G, Hugot JP, et al. (2002)

Association scan of 14,500 nonsynonymous SNPs in four diseases identifies CARD15/NOD2 analyses in spondylarthropathy. Arthritis Rheum 46: 1405 6.

autoimmunity variants. Nat Genet 39: 1329 37. 17. Storey JD, Tibshirani R (2003) Statistical significance for genomewide studies.

5. Parkes M, Barrett JC, Prescott NJ, Tremelling M, Anderson CA, et al. (2007) Proc Natl Acad Sci U S A 100: 9440 5.

Sequence variants in the autophagy gene IRGM and multiple other replicating

18. Cantero-Recasens G, Fandos C, Rubio-Moscardo F, Valverde MA, Vicente R

loci contribute to Crohn s disease susceptibility. Nat Genet 39: 830 2.

(2010) The asthma-associated ORMDL3 gene product regulates endoplasmic

6. Moffatt MF, Kabesch M, Liang L, Dixon AL, Strachan D, et al. (2007) Genetic

reticulum-mediated calcium signaling and cellular stress. Hum Mol Genet 19:

variants regulating ORMDL3 expression contribute to the risk of childhood

111 21.

asthma. Nature 448: 470 3.

19. Todd JA, Walker NM, Cooper JD, Smyth DJ, Downes K, et al. (2007) Robust

7. Barrett JC, Hansoul S, Nicolae DL, Cho JH, Duerr RH, et al. (2008) Genome-

associations of four new chromosome regions from genome-wide analyses of type

wide association defines more than 30 distinct susceptibility loci for Crohn s

1 diabetes. Nat Genet 39: 857 64.

disease. Nat Genet 40: 955 62.

20. Ito T, Yang M, Wang YH, Lande R, Gregorio J, et al. (2007) Plasmacytoid

8. Cho JH (2008) The genetics and immunopathogenesis of inflammatory bowel

dendritic cells prime IL-10-producing T regulatory cells by inducible

disease. Nat Rev Immunol 8: 458 66.

costimulator ligand. J Exp Med 204: 105 15.

9. Brown MA, Wordsworth BP, Reveille JD (2002) Genetics of ankylosing

21. Nakazawa A, Dotan I, Brimnes J, Allez M, Shao L, et al. (2004) The expression

spondylitis. Clin Exp Rheumatol 20: S43 9.

and function of costimulatory molecules B7H and B7-H1 on colonic epithelial

10. de Vlam K, Mielants H, Cuvelier C, De Keyser F, Veys EM, et al. (2000)

cells. Gastroenterology 126: 1347 57.

Spondyloarthropathy is underestimated in inflammatory bowel disease:

22. Goyette P, Lefebvre C, Ng A, Brant SR, Cho JH, et al. (2008) Gene-centric

prevalence and HLA association. J Rheumatol 27: 2860 5.

association mapping of chromosome 3p implicates MST1 in IBD pathogenesis.

11. De Vos M (2004) Review article: joint involvement in inflammatory bowel

Mucosal Immunology 1: 131 8.

disease. Aliment Pharmacol Ther 20 Suppl 4: 36 42.

12. Brewerton DA, Hart FD, Nicholls A, Caffrey M, James DC, et al. (1973) 23. van der Linden S, Valkenburg HA, Cats A (1984) Evaluation of diagnostic

Ankylosing spondylitis and HL-A 27. Lancet 1: 904 7. criteria for ankylosing spondylitis. A proposal for modification of the New York

13. Laukens D, Peeters H, Marichal D, Vander Cruyssen B, Mielants H, et al. criteria. Arthritis Rheum 27: 361 8.

(2005) CARD15 gene polymorphisms in patients with spondyloarthropathies

PLoS ONE www.plosone.org 4 November 2010 Volume 5 Issue 11 e13795

; Accepted September 27, 2010; Published November 2, 2010

Copyright: ß 2010 Laukens et al. This is an open-access article dist

Contact this candidate